WormBase Tree Display for Expr_pattern: Expr7076
expand all nodes | collapse all nodes | view schema
Expr7076 | Expression_of | Gene | WBGene00000763 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000763 | ||
Homol | Homol_homol | Y57G11C:Expr | |
Expression_data | Life_stage (2) | ||
Anatomy_term | WBbt:0005772 | ||
Type | Reporter_gene | [coq-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATAATCGCGAGTTTGAGCAG] 3' and primer B 5' [AAGGGATGATCTACCAGGAAAAA] 3'. | |
Pattern | Adult Expression: intestine; | ||
Larval Expression: intestine; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC10753 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002375 |