Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7121

expand all nodes | collapse all nodes | view schema

Name Class

Expr7121Expression_ofGeneWBGene00013529
Reflects_endogenous_expression_ofWBGene00013529
HomolHomol_homolY73F8A:Expr
Expression_data (2)
TypeReporter_gene[Y73F8A.24::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCTCACGGGCTTTGCTT] 3' and primer B 5' [CGGATGAGATCTGGAAAAACA] 3'.
PatternAdult Expression: intestine; Nervous System; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ;
Larval Expression: intestine; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC11661
ReferenceWBPaper00006525
TransgeneWBTransgene00002650