WormBase Tree Display for Expr_pattern: Expr7121
expand all nodes | collapse all nodes | view schema
Expr7121 | Expression_of | Gene | WBGene00013529 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00013529 | ||
Homol | Homol_homol | Y73F8A:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [Y73F8A.24::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCTCACGGGCTTTGCTT] 3' and primer B 5' [CGGATGAGATCTGGAAAAACA] 3'. | |
Pattern | Adult Expression: intestine; Nervous System; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: intestine; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC11661 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002650 |