Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7187

expand all nodes | collapse all nodes | view schema

Name Class

Expr7187Expression_ofGeneWBGene00003559Inferred_automatically
Reflects_endogenous_expression_ofWBGene00003559
HomolHomol_homolZK112:Expr
Expression_data (2)
TypeReporter_gene[ZK112.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGGCGAGAAAAATAAGAAGGCT] 3' and primer B 5' [ACGGTAGATTTGGATTTGGTATGT] 3'.
PatternAdult Expression: anal depressor muscle; unidentified cells in head;
Larval Expression: anal depressor muscle; unidentified cells in head;
RemarkStrain: BC12631
ReferenceWBPaper00006525
TransgeneWBTransgene00002983
Historical_geneWBGene00022659Note: This object originally referred to WBGene00022659. WBGene00022659 is now considered dead and has been merged into WBGene00003559. WBGene00003559 has replaced WBGene00022659 accordingly.