Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7231

expand all nodes | collapse all nodes | view schema

Name Class

Expr7231Expression_of (2)
HomolHomol_homolZK632:Expr
Expression_data (2)
TypeReporter_gene[cnx-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATCTTTTCGGTGATTTTCA] 3' and primer B 5' [GGTTCACGATGGTTACCTAAATTC] 3'.
PatternAdult Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
PictureWBPicture0000007147
WBPicture0000007148
RemarkStrain: BC10700
ReferenceWBPaper00006525
TransgeneWBTransgene00002364