Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7252

expand all nodes | collapse all nodes | view schema

Name Class

Expr7252Expression_ofGeneWBGene00014075
Reflects_endogenous_expression_ofWBGene00014075
HomolHomol_homolZK757:Expr
Expression_dataLife_stage (2)
Anatomy_term (20)
TypeReporter_gene[ZK757.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTGGCTCCACATAGTTCTGAT] 3' and primer B 5' [GACCCGTCAGGCTGAAAA] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; developing gonad; body wall muscle; hypodermis; seam cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons;
Picture (7)
RemarkStrain: BC15208
ReferenceWBPaper00006525
TransgeneWBTransgene00003884