WormBase Tree Display for Expr_pattern: Expr9062
expand all nodes | collapse all nodes | view schema
Expr9062 | Expression_of | Gene | WBGene00018827 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00018827 | ||
Expression_data | Anatomy_term (2) | ||
Type | Reporter_gene | ||
Pattern | In transgenic animals that carried the Ppst-2a::egfp and pst-2a(fl)::egfp constructs, EGFP 2a fluorescence was specifically observed in intestinal and pharyngeal gland cells. | ||
Picture | WBPicture0000008363 | ||
WBPicture0000008366 | |||
Remark | No GFP signal was observed in worms carrying Ppst-2b::egfp (translational fusion, forward primer 5- TTGACTCCTTTATTTGCCTGAAA 3, reverse primer 5- CATTGTTGCTACTGTGAAAAAGG 3). This suggested that the pst-2b promoter does not have inherent activity. | ||
Picture: Fig 6E, 6F. | |||
Reference | WBPaper00036358 | ||
Transgene | WBTransgene00030881 |