WormBase Tree Display for Feature: WBsf126406
expand all nodes | collapse all nodes | view schema
WBsf126406 | SMap | S_parent | Sequence | Y66A7AL |
---|---|---|---|---|
Sequence_details | Flanking_sequences | GGAATTTTTCAATTTTTTCTCCTTTTTCAG | CATTCTCATCCAAAAAAAAAATGGTAAAAA | |
Mapping_target | Y66A7AL | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 defined by RNASeq short reads (Hillier et al.) | ||
Defined_by | Defined_by_sequence (18) | |||
Defined_by_analysis (46) | ||||
Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001873 with 1 reads | |||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001875 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004864 with 3 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX004868 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008140 with 3 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 15 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 with 6 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 9 reads | ||||
Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014010 with 6 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028201 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028203 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX035162 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036881 with 6 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036882 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 with 3 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037186 with 7 reads | ||||
Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 with 6 reads | ||||
Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 with 4 reads | ||||
Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 with 3 reads | ||||
Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 with 6 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047635 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047653 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047787 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085218 with 5 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 6 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092371 with 4 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092372 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092478 with 3 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092479 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092480 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0005409.PRJNA33023.SRX139567 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000008.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145480 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145660 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0005175.PRJNA33023.SRX151618 with 1 reads | ||||
Method | SL1 |