WormBase Tree Display for Feature: WBsf015138
expand all nodes | collapse all nodes | view schema
| WBsf015138 | SMap | S_parent | Sequence | C09G5 | |
|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | TCAATCAGTACTCATTCTCCGCTTCTTCAG | AGTCTTCCACACAACTCTCCGCAGTCTCGG | ||
| Mapping_target | C09G5 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Visible | Description | SL1 trans-splice leader acceptor site | |||
| SO_term | SO:0000706 | ||||
| Defined_by | Defined_by_sequence | yk1462f04.5 | Curator_confirmed | WBPerson1846 | |
| Inferred_automatically | make_missing_tsl_features.pl | ||||
| Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_sl1_II_10708875_10708876_+_wb170 | |||||
| Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_SL1_II_10708874_10708875_+_wb170 | |||||
| mid-L3_20dC_25hrs_post-L1_bundle_of_reads_supporting_SL1_II_10708874_10708875_+_wb170 | |||||
| mid-L4_20dC_36hrs_post-L1_bundle_of_reads_supporting_SL1_II_10708874_10708875_+_wb170 | |||||
| Defined_by_paper | WBPaper00037948 | ||||
| Defined_by_analysis | RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001874 | 18 | |||
| RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001875 | 12 | ||||
| RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 | 3 | ||||
| RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 | 4 | ||||
| RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014010 | 59 | ||||
| RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036881 | 57 | ||||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 | 1 | ||||
| RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 | 20 | ||||
| RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 | 18 | ||||
| RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 | 2 | ||||
| Associations | Associated_with_CDS | C09G5.6 | |||
| Associated_with_transcript | C09G5.6.1 | ||||
| Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001874 with 18 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001875 with 12 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 3 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 with 4 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014010 with 59 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036881 with 57 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 with 20 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 with 18 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 with 2 reads | |||||
| Method | SL1 |
