WormBase Tree Display for Feature: WBsf027922
expand all nodes | collapse all nodes | view schema
| WBsf027922 | SMap | S_parent | Sequence | F43C1 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ttttattttccactaagattttggcatttc | cttcaaaactcgatcgtttagttgttagta | |
| Mapping_target | F43C1 | |||
| DNA_text | tggattatgatacatcgaaaaagaaact | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Transcription factor binding site | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00031367 | ||
| Associations | Associated_with_gene | WBGene00003401 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000103 | |||
| Bound_by_product_of | WBGene00001401 | |||
| WBGene00001402 | ||||
| Remark | FBF (fem-3 binding factor) binds to FBE (FBF binding element) in 3'UTR of mpk-1 | Paper_evidence | WBPaper00031367 | |
| Method | TF_binding_site |
