WormBase Tree Display for Feature: WBsf039767
expand all nodes | collapse all nodes | view schema
WBsf039767 | SMap | S_parent | Sequence | Y37D8A |
---|---|---|---|---|
Name | Other_name | CL-46_2 | ||
Sequence_details | Flanking_sequences | TTATTTGCACAAAACGGATGGAAGTTCAAT | TCCAAAAAAAGGTCACGGAAAATAACTATG | |
Mapping_target | Y37D8A | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Polymorphic segmental duplication as defined by the tool OrthoCluster. This feature represents one sequence from a pair of duplicons in the N2 genome. | ||
SO_term | SO:0000457 | |||
Defined_by | Defined_by_paper | WBPaper00034747 | ||
Defined_by_analysis | Vergara_OrthoCluster_duplication | |||
Remark | [090904 pad] Annotated this feature based on published data. | Paper_evidence | WBPaper00034747 | |
This Feature did not contain a pair in the downloaded data. | Paper_evidence | WBPaper00034747 | ||
Curator_confirmed | WBPerson1983 | |||
Method | segmental_duplication |