WormBase Tree Display for Feature: WBsf042160
expand all nodes | collapse all nodes | view schema
| WBsf042160 | SMap | S_parent | Sequence | K10B3 |
|---|---|---|---|---|
| Name | Other_name | CL-1021_2 | ||
| Sequence_details | Flanking_sequences | TCATTTCAGACTTAGAGAATTTGAAGCGGC | TGGCTGAAAATTGATACTACTACAATCAGT | |
| Mapping_target | K10B3 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Polymorphic segmental duplication as defined by the tool OrthoCluster. This feature represents one sequence from a pair of duplicons in the N2 genome. | ||
| SO_term | SO:0000457 | |||
| Defined_by | Defined_by_paper | WBPaper00034747 | ||
| Defined_by_analysis | Vergara_OrthoCluster_duplication | |||
| Associations | Associated_with_Feature | WBsf039167 | ||
| Remark | [090904 pad] Annotated this feature based on published data. | Paper_evidence | WBPaper00034747 | |
| Method | segmental_duplication |
