WormBase Tree Display for Feature: WBsf047492
expand all nodes | collapse all nodes | view schema
WBsf047492 | SMap | S_parent | Sequence | F59C6 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | ctccttaccttcccaggttttgcattcatgt | caatcctgagcagaacaagcattcgaagct | |
Mapping_target | F59C6 | |||
DNA_text | GTTGCTATAGCAAC | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | X-box | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00028949 | ||
Associations | Associated_with_gene | WBGene00000492 | ||
Associated_with_transcription_factor | WBTranscriptionFactor000052 | |||
Bound_by_product_of | WBGene00000914 | |||
Remark | Transcription factor binding site, 74 bp upstream of start codon, in the promoter. | |||
Method | TF_binding_site |