WormBase Tree Display for Feature: WBsf047563
expand all nodes | collapse all nodes | view schema
| WBsf047563 | SMap | S_parent | Sequence | ZK721 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | gtaaaagttcggtagtgccaattaatttacc | acaaccgctcatgtataataatatttcgtaa | |
| Mapping_target | ZK721 | |||
| DNA_text | CATATG | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | possible NdE-box | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00025009 | ||
| Associations | Associated_with_gene | WBGene00006764 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000066 | |||
| Bound_by_product_of | WBGene00001953 | |||
| Remark | The vulval expression of tni-2 and tni-3 may be regulated by the NdE-box-binding protein. | |||
| Method | TF_binding_site |
