WormBase Tree Display for Feature: WBsf047689
expand all nodes | collapse all nodes | view schema
| WBsf047689 | SMap | S_parent | Sequence | F58D2 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ACCAGCTTCCTCATTGACCGGACCTGCAAC | CCGCCGTCACGAATATTCGCGTGACCGACA | |
| Mapping_target | F58D2 | |||
| DNA_text | acctgcaacGccgccgtc | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Possible genome sequence error found in Hillier RNASeq data | ||
| the sequence of the ESTs FM249391 FM249391 confirm the suggested change; overlaps with coding transcript: F58D2.4; | ||||
| Insert acctgcaacGccgccgtc | ||||
| Possible genome sequence error found in RNASeq analysis of ten lab isolates of N2 by Kate Weber. | ||||
| SO_term | SO:0001526 | |||
| Defined_by | Defined_by_paper | WBPaper00037807 | ||
| Defined_by_analysis | RNASeq_Hillier_elegans | |||
| Confidential_remark | ||||
| Remark | [100421 pad] The underlying genomic sequence has been corrected at this position to reflect the DNA sequence as found by the Hillier RNAseq data analysis. The majority of these changes have been independently verified by the resequencing of an N2 isolate on the Illumina sequencing platform. | Curator_confirmed | WBPerson1983 | |
| From_analysis | RNASeq_Hillier_elegans | |||
| Method | Corrected_genome_sequence_error |
