WormBase Tree Display for Feature: WBsf123424
expand all nodes | collapse all nodes | view schema
| WBsf123424 | SMap | S_parent | Sequence | W09C5 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | TTTTTTTCTAAAAAACGTTCCAAATTCCAG | CTCCAAACGCTTATCTCCTCAATGGAAGAA | |
| Mapping_target | W09C5 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 defined by RNASeq short reads (Hillier et al.) | ||
| Defined_by | Defined_by_sequence | Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_sl1_I_13656165_13656166_+_wb170 | ||
| Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_SL1_I_13656164_13656165_+_wb170 | ||||
| Young_Adult_25dC_46hrs_post-L1_bundle_of_reads_supporting_SL1_I_13656164_13656165_+_wb170 | ||||
| Defined_by_analysis | RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001873 | 1 | ||
| RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 | 2 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX035162 | 1 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 | 1 | |||
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092478 | 1 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 | 2 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103989 | 5 | |||
| Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001873 with 1 reads | |||
| Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX035162 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092478 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103989 with 5 reads | ||||
| Method | SL1 |
