WormBase Tree Display for Feature: WBsf132377
expand all nodes | collapse all nodes | view schema
WBsf132377 | SMap | S_parent | Sequence | R12H7 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | ATTTTTCTCCAATAATTTCTTAATTTTCAG | TGTTCGCGATTCTCGTCTCTGCTAAACAGT | |
Mapping_target | R12H7 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 defined by RNASeq short reads (Hillier et al.) | ||
Defined_by (2) | ||||
Remark | Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 with 1 reads | |||
Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014010 with 4 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 with 1 reads | ||||
Method | SL1 |