WormBase Tree Display for Feature: WBsf204421
expand all nodes | collapse all nodes | view schema
| WBsf204421 | SMap | S_parent | Sequence | R07D5 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | CATTTTTTTTCTCAACATCCACTCTTGCAG | ATTAGCTTCTACTTGGAAAAGTACATCTTA | |
| Mapping_target | R07D5 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 defined by RNASeq short reads (Hillier et al.) | ||
| Defined_by | Defined_by_sequence | early_embryo_bundle_of_reads_supporting_SL1_X_15115444_15115445_-_wb170 | ||
| late_embryo_20dC_4.5hrs_post-early_embryo_bundle_of_reads_supporting_SL1_X_15115444_15115445_-_wb170 | ||||
| Defined_by_analysis | RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 | 1 | ||
| RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 | 1 | |||
| RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085218 | 1 | |||
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 | 2 | |||
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145660 | 1 | |||
| Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 1 reads | |||
| Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085218 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145660 with 1 reads | ||||
| Method | SL1 |
