WormBase Tree Display for Feature: WBsf634966
expand all nodes | collapse all nodes | view schema
| WBsf634966 | SMap | S_parent | Sequence | W08A12 | ||
|---|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ttttttttctaattaataattttcttctgg | aataataactattcgaataaaataaaatga | |||
| Mapping_target | W08A12 | |||||
| Source_location | 190 | CHROMOSOME_V | 3686421 | 3686422 | ||
| Origin | Species | Caenorhabditis elegans | ||||
| Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
| polyA site | ||||||
| SO_term | SO:0000553 | |||||
| Defined_by | Defined_by_paper | WBPaper00037808 | ||||
| Defined_by_analysis | adult_pA.10.15.sumCM | |||||
| dauer_pA.10.15.sumCM | ||||||
| L3_pA.10.15.sumCM | ||||||
| L4_pA.10.15.sumCM | ||||||
| Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
| Bartel data adult_pA.10.15.sumCM score: 4.0 | ||||||
| Bartel data adult_pA.10.15.sumCM score: 5.0 | ||||||
| Bartel data dauer_pA.10.15.sumCM score: 4.0 | ||||||
| Bartel data L3_pA.10.15.sumCM score: 5.0 | ||||||
| Bartel data L4_pA.10.15.sumCM score: 5.0 | ||||||
| Method | polyA_site |
