WormBase Tree Display for Feature: WBsf643927
expand all nodes | collapse all nodes | view schema
| WBsf643927 | SMap | S_parent | Sequence | T07D3 |
|---|---|---|---|---|
| Name | Public_name | MCP_0000006279 | ||
| Sequence_details | Flanking_sequences | tcccgtcatctaacactcccaacggaccgt | cgattagggggtttctcttttcattttctc | |
| Mapping_target | T07D3 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible (2) | ||||
| Defined_by | Defined_by_paper | WBPaper00042246 | ||
| Score | 35 | |||
| Associations | Associated_with_gene | WBGene00000106 | ||
| Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
| Method | TSS_region |
