WormBase Tree Display for Feature: WBsf671308
expand all nodes | collapse all nodes | view schema
| WBsf671308 | SMap | S_parent | Sequence | F14F4 |
|---|---|---|---|---|
| Name | Public_name | MCM_0000035907 | ||
| Sequence_details | Flanking_sequences | attcttctcatggcaaccacagcttccgcc | agtatctggatccatatggaatcattcgga | |
| Mapping_target | F14F4 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible (2) | ||||
| Defined_by | Defined_by_paper | WBPaper00042246 | ||
| Score | 2 | |||
| Associations | Associated_with_gene | WBGene00003411 | ||
| Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
| Method | TSS_region |
