WormBase Tree Display for Feature: WBsf702470
expand all nodes | collapse all nodes | view schema
| WBsf702470 | SMap | S_parent | Sequence | C15H7 |
|---|---|---|---|---|
| Name | Public_name | MCM_0000015796 | ||
| Sequence_details | Flanking_sequences | ggacccggagccccgccgattactagagtc | agtgcaaaagaactatgattaagtatacag | |
| Mapping_target | C15H7 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Clustered region of TSS sites. Number of tags=97. Shape score=0.247423. Assignement type=unassigned. Mode position in cluster=32. | ||
| SO_term | SO:0001240 | |||
| Defined_by | Defined_by_paper | WBPaper00042246 | ||
| Score | 97 | |||
| Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
| Method | TSS_region |
