WormBase Tree Display for Feature: WBsf899199
expand all nodes | collapse all nodes | view schema
| WBsf899199 | SMap | S_parent | Sequence | M57 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | GTTAAAATCTGAATTTTTTTCTGAAAAATAACGTGGTTTCAGGTTGTCCC | TCACGGTGTGATCTACAAAAATGCGGGAAATGAGAGAAAACTCTCGAATT | |
| Mapping_target | M57 | |||
| DNA_text | ctgaaaaataacgtggtttcaggttgtcccAtcacggtgtgatctacaaaaatgcgggaaa | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Possible genome sequence error found in RNASeq analysis of ten lab isolates of N2 by Kate Weber. | ||
| Possible genome sequence error found in RNASeq analysis of N2 and the sister strain LSJ2 from Patrick McGrath. | ||||
| The sequence of the ESTs Z14146 confirm the suggested change; This overlaps with coding transcript: Y37E11C.1; | ||||
| SNP ctgaaaaataacgtggtttcaggttgtcccAtcacggtgtgatctacaaaaatgcgggaaa | ||||
| Marked for correction | ||||
| Defined_by | Defined_by_paper | WBPaper00037807 | ||
| WBPaper00040097 | ||||
| Remark | This genome error was corrected in WS235. | |||
| Method | Corrected_genome_sequence_error |
