WormBase Tree Display for Feature: WBsf901992
expand all nodes | collapse all nodes | view schema
| WBsf901992 | SMap | S_parent | Sequence | Bm_v4_ChrX_scaffold_001 | ||||
|---|---|---|---|---|---|---|---|---|
| Status | Live | |||||||
| Sequence_details | Flanking_sequences | AAATATCTCTTTTGTATGCCTCCTCACCTGTGAATTACAG | GAGATTGTTGACAATCCACAGTTATTTGTGGAGGGTGCCA | |||||
| Mapping_target | Bm_v4_ChrX_scaffold_001 | |||||||
| Source_location | 252 | Bm_v4_ChrX_scaffold_001 | 12642208 | 12642209 | Inferred_automatically | HAL_mapping | ||
| Origin | Species | Brugia malayi | ||||||
| Visible | Description | SL1 trans-splice leader acceptor site | ||||||
| SO_term | SO:0000706 | |||||||
| Defined_by | Defined_by_person | WBPerson28591 | ||||||
| Defined_by_analysis | RNASeq_brugia_Berriman.Adult_female | |||||||
| RNASeq_brugia_Berriman.immature_microfilariae | ||||||||
| RNASeq_brugia_Berriman.microfillariae | ||||||||
| Remark | Defined by RNASeq data from RNASeq_brugia_Berriman.Adult_female with 2 reads | |||||||
| Defined by RNASeq data from RNASeq_brugia_Berriman.immature_microfilariae with 1 reads | ||||||||
| Defined by RNASeq data from RNASeq_brugia_Berriman.microfillariae with 1 reads | ||||||||
| projected from WS249 with progressive cactus | Inferred_automatically | HAL_mapping | ||||||
| Method | SL1 |
