WormBase Tree Display for Feature: WBsf908761
expand all nodes | collapse all nodes | view schema
WBsf908761 | SMap | S_parent | Sequence | Bm_v4_Chr3_scaffold_001 | ||||
---|---|---|---|---|---|---|---|---|
Status | Live | |||||||
Sequence_details | Flanking_sequences | GTGAGAATGTGAAGTAGCAGAGTTTGAGAAAGGATAACGC | TGAAATATGGATCGTTGCGCTTGACGTGAGTGTAAACTAT | |||||
Mapping_target | Bm_v4_Chr3_scaffold_001 | |||||||
Source_location | 252 | Bm_v4_Chr3_scaffold_001 | 11111521 | 11111520 | Inferred_automatically | HAL_mapping | ||
Origin | Species | Brugia malayi | ||||||
Visible | Description | SL1 trans-splice leader acceptor site | ||||||
SO_term | SO:0000706 | |||||||
Defined_by | Defined_by_analysis | RNASeq_brugia_Berriman.Adult_female | ||||||
RNASeq_brugia_Berriman.eggs_embryos | ||||||||
Remark | Defined by RNASeq data from RNASeq_brugia_Berriman.Adult_female with 1 reads | |||||||
Defined by RNASeq data from RNASeq_brugia_Berriman.eggs_embryos with 4 reads | ||||||||
projected from WS249 with progressive cactus | Inferred_automatically | HAL_mapping | ||||||
corrected strand | Inferred_automatically | HAL | ||||||
Method | SL1 |