WormBase Tree Display for Feature: WBsf912929
expand all nodes | collapse all nodes | view schema
WBsf912929 | SMap | S_parent | Sequence | Bm_v4_Chr4_scaffold_001 | ||||
---|---|---|---|---|---|---|---|---|
Status | Live | |||||||
Sequence_details | Flanking_sequences | TCAGTTCAATGCTTTTTCCAGAAAACTTACCTTTTTCTAG | GTAAGAAGGATGTCACGTTACGATATTGTCTTATACGGTG | |||||
Mapping_target | Bm_v4_Chr4_scaffold_001 | |||||||
Source_location | 252 | Bm_v4_Chr4_scaffold_001 | 7757590 | 7757591 | Inferred_automatically | HAL_mapping | ||
Origin | Species | Brugia malayi | ||||||
Visible | Description | SL1 trans-splice leader acceptor site | ||||||
SO_term | SO:0000706 | |||||||
Defined_by | Defined_by_person | WBPerson28591 | ||||||
Defined_by_analysis | RNASeq_brugia_Berriman.Adult_female | |||||||
RNASeq_brugia_Berriman.Adult_male | ||||||||
RNASeq_brugia_Berriman.BmL3_1361258 | ||||||||
RNASeq_brugia_Berriman.eggs_embryos | ||||||||
RNASeq_brugia_Berriman.immature_microfilariae | ||||||||
RNASeq_brugia_Berriman.L4 | ||||||||
RNASeq_brugia_mayhew.mf.L2.L3 | ||||||||
RNASeq_brugia_Berriman.microfillariae | ||||||||
Remark | Defined by RNASeq data from RNASeq_brugia_Berriman.Adult_female with 3 reads | |||||||
Defined by RNASeq data from RNASeq_brugia_Berriman.Adult_male with 7 reads | ||||||||
Defined by RNASeq data from RNASeq_brugia_Berriman.BmL3_1361258 with 55 reads | ||||||||
Defined by RNASeq data from RNASeq_brugia_Berriman.eggs_embryos with 7 reads | ||||||||
Defined by RNASeq data from RNASeq_brugia_Berriman.immature_microfilariae with 2 reads | ||||||||
Defined by RNASeq data from RNASeq_brugia_Berriman.L4 with 19 reads | ||||||||
Defined by RNASeq data from RNASeq_brugia_mayhew.mf.L2.L3 with 9 reads | ||||||||
Defined by RNASeq data from RNASeq_brugia_Berriman.microfillariae with 1 reads | ||||||||
projected from WS249 with progressive cactus | Inferred_automatically | HAL_mapping | ||||||
Method | SL1 |