WormBase Tree Display for Feature: WBsf919525
expand all nodes | collapse all nodes | view schema
WBsf919525 | SMap | S_parent | Sequence | R13A1 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | aaaattcttattgacatttatttttctattttag | atgagcgcaaggagtagtggaagtatgagtacagcatc | |
Mapping_target | R13A1 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 site defined by the unc-8 paper (See Supplemental data, Figure S2). | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_paper | WBPaper00043983 | ||
Defined_by_analysis (4) | ||||
Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 with 1 reads | |||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037186 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 with 1 reads | ||||
Method | SL1 |