WormBase Tree Display for Feature: WBsf919587
expand all nodes | collapse all nodes | view schema
| WBsf919587 | SMap | S_parent | Sequence | CHROMOSOME_III |
|---|---|---|---|---|
| Name | Public_name | pJW6 | ||
| Sequence_details | Flanking_sequences | attaagtttgtgataattcacaatgggaaacttc | attggagaagaagcatgctccacccttcacgt | |
| Mapping_target | CHROMOSOME_III | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This lin-39 enhancer drives expression in P5.p and P6.p and the syncytial hypodermis. | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00027690 | ||
| Associations | Associated_with_gene | WBGene00003024 | ||
| Associated_with_expression_pattern | Expr11429 | |||
| Expr11410 | ||||
| Associated_with_construct | WBCnstr00018845 | |||
| Remark | A 3.4-kb fragment located between 2.0 and 5.4 kb upstream of lin-39 that directs expression in P5.p and P6.p and the syncytial hypodermis (Fig. 1K and data not shown), however, expression was observed in few animals (<20%) and was not pursued. (See Supplemental Fig. 1B). It is possible that this is the promoter region because it is at the 5' end of the lin-39 Transcript. [2013-07-23 gw3] | |||
| Method | enhancer |
