WormBase Tree Display for Feature: WBsf919588
expand all nodes | collapse all nodes | view schema
WBsf919588 | SMap | S_parent | Sequence | C07H6 |
---|---|---|---|---|
Name | Public_name | pJW8 | ||
Sequence_details | Flanking_sequences | caaggactgggaggtcctcaatatccaata | tggaagcacctggaaggagacgatgatgat | |
Mapping_target | C07H6 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible (2) | ||||
Defined_by | Defined_by_paper | WBPaper00027690 | ||
Associations | Associated_with_gene | WBGene00003024 | ||
Associated_with_Interaction | WBInteraction000521636 | |||
WBInteraction000541815 | ||||
Associated_with_expression_pattern | Expr11430 | |||
Associated_with_construct | WBCnstr00018846 | |||
Remark | A 1.6 kb fragment covering the first lin-39 intron, which directs GFP expression in a subset of VCNs (Fig. 1L) (See Supplemental Fig. 1B). [2013-07-23 gw3] | |||
Method | enhancer |