WormBase Tree Display for Feature: WBsf919637
expand all nodes | collapse all nodes | view schema
WBsf919637 | SMap | S_parent | Sequence | T08G5 |
---|---|---|---|---|
Name | Public_name | GATA binding site (GATA2.1) | ||
Sequence_details | Flanking_sequences | tatgtttgaggcatgacttcacacacctaa | aggcctctatcacaaactagagttgtgacg | |
Mapping_target | T08G5 | |||
DNA_text | ctgataa | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | GATA binding site (GATA2.1) within the promoter region of mtl-2, bound by elt-2 | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00003700 | ||
Associations | Associated_with_gene | WBGene00003474 | ||
Associated_with_Interaction | WBInteraction000521693 | |||
WBInteraction000521694 | ||||
Associated_with_transcription_factor | WBTranscriptionFactor000728 | |||
Bound_by_product_of | WBGene00001250 | |||
Method | TF_binding_site |