WormBase Tree Display for Feature: WBsf919643
expand all nodes | collapse all nodes | view schema
WBsf919643 | SMap | S_parent | Sequence | Y22F5A |
---|---|---|---|---|
Name | Public_name | P2 regulatory element | ||
Sequence_details | Flanking_sequences | agagtgtgaatgagaaaaatacaaatttat | tccgtgggccgctctcacttatattataat | |
Mapping_target | Y22F5A | |||
DNA_text | gagtagattagcataa | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | P2 regulatory element within the promoter region of snap-25 | ||
SO_term | SO:0005836 | |||
Defined_by | Defined_by_paper | WBPaper00006136 | ||
Associations | Associated_with_gene | WBGene00004364 | ||
Associated_with_Interaction | WBInteraction000521687 | |||
Method | regulatory_region |