General
People
Want to know more about worm research?
Start here to access information about the species and data available at WormBase [Read more]
Latest updates
Need help?
Get Started
General Search
By Sequence
By Object
By Literature
Data Mining and Batch Queries
For Parasites
For Developers
Top 3 most used tools
Need help?
Get Started
Tools
Commonly requested data
Need help?
External links
We've created different user guides for distinct interests and experience levels [Read more]
Still have questions?
Please use our most recent publication to cite WormBase. Your citation is critical for ensuring the continued development of WormBase! [Read more]
expand all nodes | collapse all nodes | view schema
| WBsf919647 | SMap | S_parent | Sequence | Y22F5A |
|---|---|---|---|---|
| Name | Public_name | I2h regulatory region | ||
| Sequence_details (2) | ||||
| DNA_text | tcttctcatttcgaatgcatgtcccttttt | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible (2) | ||||
| Defined_by | Defined_by_paper | WBPaper00006136 | ||
| Associations (3) | ||||
| Bound_by_product_of (2) | ||||
| Method | TF_binding_site |
