WormBase Tree Display for Feature: WBsf919651
expand all nodes | collapse all nodes | view schema
| WBsf919651 | SMap | S_parent | Sequence | F36H1 |
|---|---|---|---|---|
| Name | Public_name | POU homeodomain protein binding site | ||
| Sequence_details | Flanking_sequences | ttcaaaattctagaacttcccgtctctccc | acctgtgtattttatgctggttttttcttg | |
| Mapping_target | F36H1 | |||
| DNA_text | tattcaatgc | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | POU homeodomain protein binding site within the lin-3 anchor cell enhancer element (ACEL) | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00006370 | ||
| Associations | Associated_with_transcription_factor | WBTranscriptionFactor000094 | ||
| Bound_by_product_of | WBGene00006818 | |||
| WBGene00000441 | ||||
| Remark | POU proteins do not play a role in the anchor cell (AC) specific expression of lin-3 | Paper_evidence | WBPaper00006370 | |
| Method | TF_binding_site |
