WormBase Tree Display for Feature: WBsf946069
expand all nodes | collapse all nodes | view schema
WBsf946069 | SMap | S_parent | Sequence | F11A6 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | tttaataatttttattttctttcagttcag | cccctttacaatcaactttctacaaaaacc | |
Mapping_target | F11A6 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 | 1 | |
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001873 | 1 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR124275.27436862.+.SL1 - 68M) from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 with 1 reads | |||
Defined by RNASeq data (example read: SRR006516.2203280.+.SL1 - 30M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001873 with 1 reads | ||||
Defined by RNASeq data (example read: SRR031118.21634853.+.SL1 - 29M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 with 1 reads | ||||
Method | SL1 |