WormBase Tree Display for Feature: WBsf946072
expand all nodes | collapse all nodes | view schema
WBsf946072 | SMap | S_parent | Sequence | F11A6 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | attgaaataaacataatttctgatttacag | agtacaattgtcactttggaacatccaaga | |
Mapping_target | F11A6 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL2 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 | 1 | |
RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049744 | 1 | |||
RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047653 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR124275.11531692.+.SL2f - 67M) from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 with 1 reads | |||
Defined by RNASeq data (example read: SRR137925.9807643.+.SL2 - 67M) from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049744 with 1 reads | ||||
Defined by RNASeq data (example read: SRR125337.1806436.+.SL2f - 68M) from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047653 with 1 reads | ||||
Method | SL2 |