WormBase Tree Display for Feature: WBsf949433
expand all nodes | collapse all nodes | view schema
WBsf949433 | SMap | S_parent | Sequence | C48B6 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | taaatatttctaatcttgaaaattttccag | agtcgtgaagtagctgatcttatcaaaaac | |
Mapping_target | C48B6 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL2 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 | 1 | |
RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145444 | 1 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR316929.23824100.+.SL2f + 92M) from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 1 reads | |||
Defined by RNASeq data (example read: SRR493076.105457328.+.SL2 + 63M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145444 with 1 reads | ||||
Defined by RNASeq data (example read: SRR031113.12018614.+.SL2 + 28M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 1 reads | ||||
Method | SL2 |