WormBase Tree Display for Feature: WBsf950886
expand all nodes | collapse all nodes | view schema
WBsf950886 | SMap | S_parent | Sequence | C09G5 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | tacaaaaaattaataaaatcttcatttcag | taatgaccgaatcagctcccagcgcatttt | |
Mapping_target | C09G5 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL2 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 | 1 | |
RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0005175.PRJNA33023.SRX151618 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR124273.23858293.+.SL2f - 66M) from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 with 1 reads | |||
Defined by RNASeq data (example read: SRR504339.1727858.+.SL2h - 90M) from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0005175.PRJNA33023.SRX151618 with 1 reads | ||||
Method | SL2 |