WormBase Tree Display for Feature: WBsf958337
expand all nodes | collapse all nodes | view schema
WBsf958337 | SMap | S_parent | Sequence | F54D8 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | ttttattcaaaaataattacctattttcag | ccaagatgcatcgacatattaccaagaaga | |
Mapping_target | F54D8 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 | 1 | |
RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 | 1 | |||
RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004864 | 1 | |||
RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 | 3 | |||
RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 | 1 | |||
RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 | 3 | |||
Remark | Defined by RNASeq data (example read: SRR027904.10351073.+.SL1 + 28M) from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 with 1 reads | |||
Defined by RNASeq data (example read: SRR089797.21753938.+.SL1 + 68M) from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 with 1 reads | ||||
Defined by RNASeq data (example read: SRR016671.14397898.+.SL1 + 28M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004864 with 1 reads | ||||
Defined by RNASeq data (example read: SRR089796.30445850.+.SL1 + 28M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 with 3 reads | ||||
Defined by RNASeq data (example read: SRR016678.7618596.+.SL1 + 28M) from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 with 1 reads | ||||
Defined by RNASeq data (example read: SRR124256.5962192.+.SL1 + 68M) from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 with 3 reads | ||||
Method | SL1 |