WormBase Tree Display for Feature: WBsf963010
expand all nodes | collapse all nodes | view schema
| WBsf963010 | SMap | S_parent | Sequence | Y94H6A |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ccaagagatattattttttttaattttcag | gacaaaacttgttttcttctatacatctgt | |
| Mapping_target | Y94H6A | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 trans-splice leader acceptor site | ||
| SO_term | SO:0000706 | |||
| Defined_by | Defined_by_analysis | RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX050610 | 1 | |
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 | 3 | |||
| RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049270 | 1 | |||
| RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 | 1 | |||
| RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 | 3 | |||
| RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX049745 | 29 | |||
| RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX050630 | 4 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 | 1 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 | 1 | |||
| Remark | Defined by RNASeq data (example read: SRR139094.1162948.+.SL1 + 27M) from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX050610 with 1 reads | |||
| Defined by RNASeq data (example read: SRR089796.10759628.+.SL1 + 29M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 with 3 reads | ||||
| Defined by RNASeq data (example read: SRR136599.1889260.+.SL1 + 29M1S) from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049270 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR089823.26493883.+.SL1 + 68M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR136597.17590988.+.SL1 + 27M) from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 with 3 reads | ||||
| Defined by RNASeq data (example read: SRR137926.15159010.+.SL1 + 67M) from RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX049745 with 29 reads | ||||
| Defined by RNASeq data (example read: SRR139148.2323533.+.SL1 + 27M1S) from RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX050630 with 4 reads | ||||
| Defined by RNASeq data (example read: SRR089358.25988414.+.SL1 + 68M) from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR089363.23717557.+.SL1 + 69M) from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 with 1 reads | ||||
| Method | SL1 |
