WormBase Tree Display for Feature: WBsf963105
expand all nodes | collapse all nodes | view schema
| WBsf963105 | SMap | S_parent | Sequence | Y54G2A |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | tttttcttttttcaaatttttttttgtcag | attatgctcaaggatatcttgtctcgtcca | |
| Mapping_target | Y54G2A | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 trans-splice leader acceptor site | ||
| SO_term | SO:0000706 | |||
| Defined_by | Defined_by_analysis | RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037199 | 1 | |
| RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 | 1 | |||
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092479 | 1 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 | 1 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 | 1 | |||
| Remark | Defined by RNASeq data (example read: SRR089798.71216.+.SL1 - 24M47N43M) from RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037199 with 1 reads | |||
| Defined by RNASeq data (example read: SRR089797.19506188.+.SL1 - 24M47N43M) from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR332926.4606241.+.SL1 - 49M47N43M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092479 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR089358.5545135.+.SL1 - 25M47N43M) from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR031113.4726185.+.SL1 - 28M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 1 reads | ||||
| Method | SL1 |
