WormBase Tree Display for Feature: WBsf963289
expand all nodes | collapse all nodes | view schema
WBsf963289 | SMap | S_parent | Sequence | M57 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | tcttcatcctttatctcttactttctccag | cctcaatacgaatcgaaagtggacgaaaaa | |
Mapping_target | M57 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible (2) | ||||
Defined_by | Defined_by_analysis | RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 | 1 | |
RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR124275.7095488.+.SL1 + 68M) from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 with 1 reads | |||
Defined by RNASeq data (example read: SRR089823.16111550.+.SL1 + 69M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 with 1 reads | ||||
Method | SL1 |