WormBase Tree Display for Feature: WBsf963296
expand all nodes | collapse all nodes | view schema
| WBsf963296 | SMap | S_parent | Sequence | M57 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | agtccccgctgaaaaaatgcgtattttcag | gttttcagatccccgaaaatcactatccac | |
| Mapping_target | M57 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 trans-splice leader acceptor site | ||
| SO_term | SO:0000706 | |||
| Defined_by | Defined_by_analysis | RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 | 1 | |
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 | 1 | |||
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092480 | 1 | |||
| RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145661 | 1 | |||
| RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001875 | 1 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0005175.PRJNA33023.SRX151618 | 1 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 | 1 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 | 2 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 | 1 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 | 1 | |||
| Remark | Defined by RNASeq data (example read: SRR023534.14007986.+.SL1 + 29M) from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 1 reads | |||
| Defined by RNASeq data (example read: SRR089795.15163143.+.SL1 + 30M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR332925.595082.+.SL1 + 69M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092480 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR493362.9444298.+.SL1 + 92M) from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145661 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR006520.27361940.+.SL1 + 27M) from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001875 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR504338.5319397.+.SL1 + 92M) from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0005175.PRJNA33023.SRX151618 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR089354.9581975.+.SL1 + 68M) from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR089359.26738291.+.SL1 + 68M) from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 with 2 reads | ||||
| Defined by RNASeq data (example read: SRR031117.35919114.+.SL1 + 28M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR031120.6999937.+.SL1 + 28M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 1 reads | ||||
| Method | SL1 |
