WormBase Tree Display for Feature: WBsf974505
expand all nodes | collapse all nodes | view schema
WBsf974505 | SMap | S_parent | Sequence | R08E3 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | aaaaaatttaaaaaaaaagattgatttcag | accagggtcatcagtttctggaaagtgtag | |
Mapping_target | R08E3 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145444 | 1 | |
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR493076.51501212.+.SL1 + 59M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145444 with 1 reads | |||
Defined by RNASeq data (example read: SRR031120.61738508.+.SL1 + 28M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 1 reads | ||||
Method | SL1 |