WormBase Tree Display for Feature: WBsf975989
expand all nodes | collapse all nodes | view schema
| WBsf975989 | SMap | S_parent | Sequence | Y38C1AA |
|---|---|---|---|---|
| Name | Public_name | Promoter region pnc-1a | ||
| Sequence_details | Flanking_sequences | ccgcaggctccagaacttgcttcaggacct | gtgagttttggtggataggacggtgggaca | |
| Mapping_target | Y38C1AA | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Promoter region pnc-1a | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00035288 | ||
| WBPaper00045161 | ||||
| Associations | Associated_with_gene | WBGene00021395 | ||
| Associated_with_Interaction | WBInteraction000521675 | |||
| Associated_with_expression_pattern | Expr11754 | |||
| Expr11809 | ||||
| Remark | Promoter is described as spanning exon1a and 1.8kb upstream. | Paper_evidence | WBPaper00035288 | |
| The functional promoter is almost certainly shorter than the annotated sequence | Person_evidence | WBPerson4983 | ||
| Method | promoter |
