WormBase Tree Display for Feature: WBsf977694
expand all nodes | collapse all nodes | view schema
WBsf977694 | SMap | S_parent | Sequence | F08G2 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | ttaccggaattggacattttcggcataccg | tccgggattcttctaggccgccgccggcgc | |
Mapping_target | F08G2 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Highly Occupied Target (HOT) region bound by many transcription factors. | ||
Defined_by (2) | ||||
Score | 76 | |||
Associations | Associated_with_transcription_factor | WBTranscriptionFactor001157 | ||
Bound_by_product_of (75) | ||||
Remark | [141104 gw3] This is reanalysis of the HOT regions in the modENCODE data using updated data. The previous dataset has an Analysis of 'modENCODE_HOT'. | Paper_evidence | WBPaper00045011 | |
Method | binding_site_region |