WormBase Tree Display for Feature: WBsf978334
expand all nodes | collapse all nodes | view schema
| WBsf978334 | SMap | S_parent | Sequence | T23F11 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | gtaatagagttctttagagtccatatttgt | cgtagttatcaatattgatccgggtagtac | |
| Mapping_target | T23F11 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Promoter region of T23F11.4. | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00011956 | ||
| Associated_with_Interaction | WBInteraction000531249 | |||
| WBInteraction000531250 | ||||
| WBInteraction000531251 | ||||
| WBInteraction000531252 | ||||
| WBInteraction000531253 | ||||
| WBInteraction000531254 | ||||
| WBInteraction000531255 | ||||
| WBInteraction000531256 | ||||
| WBInteraction000531257 | ||||
| Remark | [150922 gw3] This is a region upstream of T23F11.4 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
| Method | promoter |
