WormBase Tree Display for RNAi: WBRNAi00000251
expand all nodes | collapse all nodes | view schema
WBRNAi00000251 | History_name | SA:yk150c2 | |||
---|---|---|---|---|---|
Homol | Homol_homol | B0410:RNAi | |||
Sequence_info | DNA_text | tgaaaaacgtggaaattctgtcgttgatcgtgggatccatatcatatacaataccgttctcatccatgaactggttgggcgagaagttgtcattgatttgtttttgctgaaaacagtattggtgaaaaccgattcaaatctaaaaaattgaaaagtattgacttacccaatcatcttctccgcgcaaatgaagaatcggacggaaatcagtgttttgcattcctatccgacgtcgcgtcaatttctcagatctgtaggcatcgagaagactcattgacgagacgattgtgacaattagattgaagaaaataatctgacggagtatctgcgcgaacattttgatagctttcgacttttgaaggttgtgttgaagatgacacttcaaaaaactggacgatcgagacccaaatacggaagtgtaaagggaaagag | yk150c2 | ||
Sequence | yk150c2 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | B0410.3 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00015172 | Inferred_automatically | RNAi_primary | ||
Transcript | B0410.3.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype_not_observed | WBPhenotype:0000050 | ||||
WBPhenotype:0000062 | |||||
WBPhenotype:0000535 | |||||
WBPhenotype:0000689 | |||||
WBPhenotype:0000886 | |||||
Remark | yk150c2 | ||||
clone does not match to the reported genomic sequence | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |