WormBase Tree Display for RNAi: WBRNAi00000602
expand all nodes | collapse all nodes | view schema
WBRNAi00000602 | History_name | SA:yk221d9 | |||
---|---|---|---|---|---|
Homol | Homol_homol | C08B11:RNAi | |||
Sequence_info | DNA_text | gcttaattgcctcaatccagtcttgttctttttggaactcagcaacctcaagtgggagctcacgaagcccatccagctcgtagaccttattaccgattggcacgtatgtcacaaagtgatagttatcctccgattctccgcctttgatatcaagttcgaaaagagtctgacgagaaaaactattgtgaacagtgcgaatttcctcgctgttcgaaagacaatgaccgcgagtattcggatccaagtcaatcgcgaattctttgtactgattcaggatatttccaagcttcacatcggtatcttccacgttcataagcaagttgatgagagcttgagtagcacaagcgttttgaattgtt | yk221d9 | ||
Sequence | yk221d9 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | C08B11.7 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00006724 | Inferred_automatically | RNAi_primary | ||
Transcript | C08B11.7.2 | Inferred_automatically | RNAi_primary | ||
C08B11.7.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype | WBPhenotype:0000050 | Remark | %penetrance | ||
Penetrance | Range | 95 | |||
WBPhenotype:0000059 | |||||
Remark | yk221d9 | ||||
(24hr-) embryonic lethal (95%),escapers: L1 arrest | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |