WormBase Tree Display for RNAi: WBRNAi00000627
expand all nodes | collapse all nodes | view schema
WBRNAi00000627 | History_name | SA:yk224b11 | |||
---|---|---|---|---|---|
Homol | Homol_homol | W07G4:RNAi | |||
Sequence_info | DNA_text | aaattctaaatgaaggagttggacacgtttatcgtaacaatatgggatcacttccacgtcttcgaagtgctcaagatgaagctgatgatgcgtattacacatatacggcatctagaaaatacaaaaataccacatctacattcaacagggaatagaatattattcattgatttttaattatttttaagttatgtgtacaaatgatctctcttttcagttgttttgtatctcttaaattttctttcattttcccattttattcatatctgtgactctagtttctttctattatttttct | yk224b11 | ||
Sequence | yk224b11 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | F15B9.7b | Inferred_automatically | RNAi_primary | |
F15B9.7a | Inferred_automatically | RNAi_primary | |||
F15B9.7c | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00001475 | Inferred_automatically | RNAi_primary | ||
Transcript | F15B9.7b.1 | Inferred_automatically | RNAi_primary | ||
F15B9.7a.1 | Inferred_automatically | RNAi_primary | |||
F15B9.7c.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype | WBPhenotype:0000689 | ||||
WBPhenotype:0001037 | Remark | %penetrance | |||
Penetrance | Range | 18 | |||
Remark | yk224b11 | ||||
F1 sterile (18%),(24hr-) P0 few progeny | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |