WormBase Tree Display for RNAi: WBRNAi00001110
expand all nodes | collapse all nodes | view schema
WBRNAi00001110 | History_name | SA:yk282c3 | |||
---|---|---|---|---|---|
Homol | Homol_homol | Y57E12AL:RNAi | |||
Sequence_info | DNA_text | aaagagtacatcagccgtatttagcgcttcatcttggaatcaaagttgagataatcagatgggaaaatggactcgtcgcggttgagcagcatgtcgaagtgaagacgtgacgactggaacacaccgtctggtcctcgattaatctgtgcagcagagttgagctcactgaaaatttgttatattgttttttcagttattttacggtctcacagcaagcgttgctctgcttgagcatttccggagagaagacgttgagcgttcaagtagttctcgatctttggattcatgcgggatccatcggcaagcaactcgtgggcaacaacgttgttcggctgaaaaataaaaaaatttaatacgattcgaaaatcgggtgagacggaataaaaacacatggttttgtcagagcaaaattttttaaaaaatccactaaccatttttggagcc | yk282c3 | ||
Sequence | yk282c3 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | Y57E12AL.6 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00021959 | Inferred_automatically | RNAi_primary | ||
Transcript | Y57E12AL.6.2 | Inferred_automatically | RNAi_primary | ||
Y57E12AL.6.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype | WBPhenotype:0000032 | ||||
WBPhenotype:0000689 | |||||
Remark | yk282c3 | ||||
P0 sterile,unhealthy | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |