WormBase Tree Display for RNAi: WBRNAi00007398
expand all nodes | collapse all nodes | view schema
WBRNAi00007398 | History_name | SA:yk317f5 | ||
---|---|---|---|---|
Homol | Homol_homol | Y39A1A:RNAi | ||
Sequence_info | DNA_text | gaaattcctgaaaaagtattttggaaattttttgaaaaaaaaacttatatttttttatcgccttaaaagttttaacggccttttttttaagatttagaaatattttagttttatatttgagaaatattttttgtctaattttttaatagatttttcaaattttaaatttaaaaaaaacgttttggaaattgtattaatttttcacattaatatttggctcattctctattactgtaacataaaattctgagaatgcgtattgggcaccatactttacgcgcaaagtatctcttagcgaaa | yk317f5 | |
Sequence | yk317f5 | |||
Experiment | Laboratory | SA | ||
YK | ||||
Date | 06 Feb 2001 00:00:00 | |||
Species | Caenorhabditis elegans | |||
Reference | WBPaper00004651 | |||
Phenotype_not_observed | WBPhenotype:0000050 | |||
WBPhenotype:0000062 | ||||
WBPhenotype:0000535 | ||||
WBPhenotype:0000689 | ||||
WBPhenotype:0000886 | ||||
Remark | yk317f5 | |||
Y39A1A,no ORF name is assigned | ||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | ||||
Method | RNAi |